Skip to main content

187. Repeated DNA Sequences|Leetcode solution

 187Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A''C''G', and 'T'.

  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

 

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

 

Constraints:

  • 1 <= s.length <= 105
  • s[i] is either 'A''C''G', or 'T'.

solution:

class Solution {
public:
    vector<string> findRepeatedDnaSequences(string s) {
        
        int size = s.length();
        unordered_map<string, int>umap;
        vector<string>ans;
        if(size <= 10)
            return ans;
        for(int i =0 ; i <= size-10; i++ )
        {
            string t = s.substr(i , 10);
            umap[t]++;
        }
        for(int i =0 ; i < size-10; i++ )
        {
            string t = s.substr(i , 10);
            if(umap[t] > 1)
            {
                ans.push_back(t);
                umap[t] =0;

            }
        }
        return ans;
    }
};

Comments

Popular posts from this blog

2485. Find the Pivot Integer | Binary search

  Given a positive integer   n , find the   pivot integer   x   such that: The sum of all elements between  1  and  x  inclusively equals the sum of all elements between  x  and  n  inclusively. Return  the pivot integer  x . If no such integer exists, return  -1 . It is guaranteed that there will be at most one pivot index for the given input.   Example 1: Input: n = 8 Output: 6 Explanation: 6 is the pivot integer since: 1 + 2 + 3 + 4 + 5 + 6 = 6 + 7 + 8 = 21. Example 2: Input: n = 1 Output: 1 Explanation: 1 is the pivot integer since: 1 = 1. Example 3: Input: n = 4 Output: -1 Explanation: It can be proved that no such integer exist.   Constraints: 1 <= n <= 1000 Solution : class Solution { publ ic:     int pivotInteger( int n ) {         int sum = (( n )*( n + 1 ))/ 2 ;         int i = 1 ;         int j =...

leetcode 48 solution

  48 .  Rotate Image You are given an  n x n  2D  matrix  representing an image, rotate the image by  90  degrees (clockwise). You have to rotate the image  in-place , which means you have to modify the input 2D matrix directly.  DO NOT  allocate another 2D matrix and do the rotation.   Example 1: Input: matrix = [[1,2,3],[4,5,6],[7,8,9]] Output: [[7,4,1],[8,5,2],[9,6,3]] Example 2: Input: matrix = [[5,1,9,11],[2,4,8,10],[13,3,6,7],[15,14,12,16]] Output: [[15,13,2,5],[14,3,4,1],[12,6,8,9],[16,7,10,11]]   Constraints: n == matrix.length == matrix[i].length 1 <= n <= 20 -1000 <= matrix[i][j] <= 1000 solution: class Solution { public:     void swap(int& a , int &b)     {         int c ;         c = a;         a = b;         b = c;     }     void transpose (vector<vector<int>...

Regular Expression Matching Leetcode Solution

Regular Expression Matching Given an input string s and a pattern p, implement regular expression matching with support for '.' and '*' where: '.' Matches any single character.​​​​ '*' Matches zero or more of the preceding element. The matching should cover the entire input string (not partial). Example 1: Input: s = "aa", p = "a"  Output: false  Explanation: "a" does not match the entire string "aa". Example 2: Input: s = "aa", p = "a*"  Output: true  Explanation: '*' means zero or more of the preceding element, 'a'. Therefore, by repeating 'a' once, it becomes "aa". Example 3: Input: s = "ab", p = ".*"  Output: true  Explanation: ".*" means "zero or more (*) of any character (.)". Constraints: 1 <= s.length <= 20 1 <= p.length <= 20 s contains only lowercase English letters. p contains only lowercase Englis...